You are here: Support » Support » Free universal primers

Partner Link

 

Customised cell lines in 30 days.

Free universal primers

Primer name Sequence 5'-3'
1492r tacggytaccttgttacgactt
16S-1392r ACGGGCGGTGTGTRC
16S-27f agagtttgatcmtggctcag
35S-A AAGGGTCTTGCGAAGGATAG
35S-B AGTGGAAAAGGAAGGTGGCT
3'-Gal 4 GAACTTGCGGGGTTTTTC
BAC1 GCTCGTATGTTGTGTGGAATTG
BAC2 CCCAGTCACGACGTTGTAAAAC
BGH-Reverse TAGAAGGCACAGTCGAGG
CMV-F CGCAAATGGGCGGTAGGCGTG
EBV-RP GTGGTTTGTCCAAACTCATC
EGF1 CCAAGCTATTTAGGTGACAC
EGF2 GGGGATGTGCTGCAAGG
GFPN1-5 GAGCTCAAGCTTCGAATTC
GLprimer1 TGTATCTTATGGTACTGTAACTG
KAN2-FP ACCTACAACAAAGCTCTCATCAACC
KAN2-RP GCAATGTAACATCAGAGATTTTGAG
KS TCGAGGTCGACGGTATC
LPP1 atacgactcactatagggagac
LPP2 acaaattggactaatcgatggc
M13-FP TGTAAAACGACGGCCAGT
M13-RP CAGGAAACAGCTATGACC
pACT2-FP GATGATGAAGATACCCCAC
pACT2-RP CAGTTGAAGTGAACTTGC
pBacPAC-RP GTCTGTAAATCAACAACGC
pBAD-FP ATGCCATAGCATTTTTATCC
pBakPAC-FP TAAAATGATAACCATCTCGC
pBR1 CGAAAAGTGCCACCTGAC
pBR2 GGAGCCACTATCGACTAC
pBR3 TCCCCATCGGTGATGTC
PBR4 CTCGGCACCGTCACC
pc3.1GFP-Topo-RP CCCATTAACATCACC
pcDNA1.1-RP CTCTGTAGGTAGTTTGTCC
pcDNA1.1-RP/1 TAGAATCAGTAGTTTAACAC
pcDNA3.1-FP ctctggctaactagagaac
pcDNA3.1-RP/1 CAAACAACAGATGGCTGGC
PCR1 CGGGCCTCTTCGCTATT
PCR1minus1 GGGCCTCTTCGCTATT
PCR2 TTAGCTCACTCATTAGG
pDONOR-FP TAACGCTAGCATGGATCTC
pDONOR-RP GCAATGTAACATCAGAGAT
pEGFP_C2-FP GATCACATGGTCCTGCTG
pEGFP_C2-RP TTTAAAGCAAGTAAAACCTC
pEGFP_N CCGTCCAGCTCGACCAG
pEGFP-FP TTTAGTGAACCGTCAGATC
pEGFP-RP AACAGCTCCTCGCCCTTG
pESP-RP TCCAAAAGAAGTCGAGTGG
pET-24a GGGTTATGCTAGTTATTGCTCAG
pET30er-FP tcatcattcttctggtctg
pET36b-FP GCTAAATTCGAACGCCAG
pETBlue-RP aatagctttaatgcggtag
pET-RP CTAGTTATTGCTCAGCGG
pGBT9-FP AGTGCGACATCATCATCG
pGBT9-RP CGTTTTAAAACCTAAGAGTCAC
pGEX-3 GGAGCTGCATGTGTCAGAG
pGEX3-RP TCAAGAATTATACACTCCG
pGEX-5 CTGGCAAGCCACGTTTGG
pGEX5-FP AACGTATTGAAGCTATCCC
pGFP-FP GAGTTTGTAACAGCTGCTG
pGL2 TCTTTATGTTTTTGGCGTC
pGL3-1 GAGCTGACTGGGTTGAAG
pGL3-RV3 CTAGCAAAATAGGCTGTCC
pIRES-RP TATAGACAAACGCACACCG
pJet1-FP actactcgatgagttttcgg
pJet1-RP tgaggtggttagcatagttc
pMalE TCAGACTGTCGATGAAGC
pMT-FP CATCTCAGTGCAACTAAAG
PolyA-B AAAAAAAAAAAAAAAAAAAAAAAB
PolyC-D CCCCCCCCCCCCD
PolyT-V TTTTTTTTTTTTTTTTTTTTTv
pQE-FP CGGATAACAATTTCACACAG
pQE-RP GTTCTGAGGTCATTACTGG
pQE-RP-50 CTAGCTTGGATTCTCACC
pREP-FP GCTCGATACAATAAACGCC
pRH-FP ctgtctctatactcccctatag
pRH-RP caaaattcaatagttactatcgc
pRSET-RP ATGCTAGTTATTGCTCAGC
pRSET-RPnew GGGTTATGCTAGTTATTGC
pTal-FP CGGGAGGTACTTGGAGCG
pTeSp-1 CCTCCATAGAAGACACC
pTeSp-2 GCCCTGCCACTCATCG
pTI2-1-1 GGCAAATATTCTGAAATGAGC
pTI2-1-2 GCGTTTCACTTCTGAGTTCG
pTrcHis-FP GACCGGAATTATCGATTAAC
pTrcHis-RP CTGATTTAATCTGTATCAGG
pTYB-FP GGAAGACGATTATTATGGG
pUC-F GCCAGTGAATTCGAGCTCGG
pUC-R TGCCTGCAGGTCGACTCTAG
pVL1 GGGTTTAACATTACGGATTTC
pVL2 GACGCACAAACTAATATCAC
pVP22-FP CGCTTCTCGCCCCAGAC
RPC ACAGCTATGACCATGATTACG
SK CGCTCTAGAACTAGTGGATC
SP6 ATTTAGGTGACACTATAGAA
T3 ATTAACCCTCACTAAAGGGA
T7 TAATACGACTCACTATAGGG
T7-981079 TAATACGACTCACTATAG
T7minus1 AATACGACTCACTATAGGG
TET-1 FP-1 gggtgcgcatgatcctctagagt
TET-1 RP-1 taaattgcactgaaatctagaaata
Topo-1 TCGGATCCACTAGTAACG
Topo-2 GTGTGATGGATATCTGC
Topo-2N AGATGCATGCTCGAGCGG
TriplEx5`LD GAAGCGCGCCATTGTGTTGG
UP-2 CGTTGTAAAACGACGGCC
UP-40 GTTTTCCCAGTCACGAC
   
Copyright © 2014 GATC Biotech AG. All rights reserved.
Share RSS-Feed twitter facebook google plus linkedin xing